1.Brief Introduction
We provide programmatic access to various data resources and analysis tools via our web service APIs. To ensure client and server software from various sources will work well together, the web services are built on the REpresentational State Transfer (REST) open standard.
2.How to use?
The following steps will guide you how to use the web services.
Step 1: Download a client program in the section3 form.
Step 2: Configure the client-side environment. Java,Perl or Python and libraries of dependencies are required.You can use pip to install Python packages and cpan to search and install Perl modules.
Step 3: Run the client program. Firstly, run the program without any arguments to see details of usage, then submit your job with proper arguments. The following are two examples of job submission using the Python2 clients:
PSISearch2:
python psisearch2d_urllib2.py --email <email> --database <db> --sequence <seqFile> --evalue 0.001 --num_iter 3 [options...]WES:
python wesCromwellcommon_urlib2.py -S <sampleid> --email <email> --title <title> --adapter1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --adapter2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --qc_quality 20 --uploadid <uploadid>Note: For WGS and WES, please use the Upload Tool provided at the bottom of the table underneath. You will get a UploadID from the Upload Tool and process WGS/WES analysis with the UploadID .
3.Web Service Clients
Sample clients are provided for multiple programming languages. For details of how to use these clients, download the client and run the program without any arguments.
| Tools | Description | Language | Download | Requirements |
|---|---|---|---|---|
| PSISearch2D | PSISearch2D Query-seeded sequence iterative search with novel visualizations for domain & sequence alignments ,combined with Simth-Warterman algorithm. | Perl | psisearch2d_lwp.pl |
LWP and XML::Simple |
| Python2 | psisearch2d_urllib2.py |
urllib2 and xmltramp | ||
| Python3 | psisearch2d_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | psisearch2d.jar |
Java 8 | ||
| SBT BLAST | SBT-BLAST combined SBT algorithm and BLAST to perform ultrafast local alignment search in large scale RNA-seq data. | Perl | sbtblast_lwp.pl |
LWP and XML::Simple |
| Python2 | sbtblast_urllib2.py |
urllib2 and xmltramp | ||
| Python3 | sbtblast_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | sbtblast.jar |
Java 8 | ||
| BLAST | BLAST stands for Basic Local Alignment Search Tool.The emphasis of this tool is to find regions of sequence similarity, which will yield functional and evolutionary clues about the structure and function of your sequence. | Perl | ncbiblast_lwp.pl |
LWP and XML::Simple |
| Python2 | ncbiblast_urllib2.py |
urllib2 and xmltramp | ||
| Python3 | ncbiblast_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | ncbiblast.jar |
Java 8 | ||
| FASTA | FASTA (pronounced FAST-AYE) is a suite of programs for searching nucleotide or protein databases with a query sequence. FASTA itself performs a local heuristic search of a protein or nucleotide database for a query of the same type. FASTX and FASTY translate a nucleotide query for searching a protein database. TFASTX and TFASTY translate a nucleotide database to be searched with a protein query. Optimal searches are available with the programs SSEARCH (local), GGSEARCH (global) and GLSEARCH (global query against local database). | Perl | fasta_lwp.pl |
LWP and XML::Simple |
| Python2 | fasta_urllib2.py |
urllib2 and xmltramp | ||
| Python3 | fasta_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | fasta.jar |
Java 8 | ||
| Clustal-Omega | Clustal Omega is a multiple sequence alignment program for proteins. It produces biologically meaningful multiple sequence alignments of divergent sequences. Evolutionary relationships can be seen via viewing Cladograms or Phylograms. | Perl | clustalo_lwp.pl |
LWP and XML::Simple |
| Python2 | clustalo_urllib_python27.py |
urllib2 and xmltramp | ||
| Python3 | clustalo_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | clustalo.jar |
Java 8 | ||
| InterProScan5 | InterProScan is a tool that combines different protein signature recognition methods into one resource. The number of signature databases and their associated scanning tools, as well as the further refinement procedures, increases the complexity of the problem. | Perl | iprscan5_lwp.pl |
LWP and XML::Simple |
| Python2 | iprscan5_urllib2.py |
urllib2 and xmltramp | ||
| Python3 | iprscan5_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | iprscan5.jar |
Java 8 | ||
| DeepSea | Predicting the sequence specificities of DNA- and RNA-binding proteins by deep learning. | Perl | deepsea.pl |
LWP and XML::Simple |
| Python2 | deepsea_urllib2.py |
urllib2 and xmltramp | ||
| Python3 | deepsea_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | deepsea.jar |
java8 | ||
| Sequence Profiler | Sequence Profiler is a ultility of DeepSEA that performs "in silico saturated mutagenesis" analysis for discovering informative sequence features. | Perl | deepsea2_lwp.pl |
LWP and XML::Simple |
| Python2 | deepsea2_urllib2.py |
urllib2 and xmltramp | ||
| Python3 | deepsea2_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | SequenceProfiler.jar |
java8 | ||
| DeepBind | Predicting the sequence specificities of DNA- and RNA-binding proteins by deep learning. | Perl | deepbind.pl |
LWP and XML::Simple |
| Python2 | deepbind_urllib2.py |
urllib2 and xmltramp | ||
| Python3 | deepbind_urllib3.py |
urllib3 and xmltramp2 | ||
| Java | deepbind.jar |
java8 | ||
| WES | Human Whole Exome Sequencing Analysis Workflow(Cromwell implement) | Perl | wesCromwellcommon.pl |
LWP and XML::Simple |
| Python2 | wesCromwellcommon_urllib2.py |
urllib2 , xmltramp and json | ||
| Python3 | wesCromwellcommon_urllib3.py |
urllib3 , xmltramp2 and json | ||
| Java | wescromwell.jar |
java8 | ||
| WESMAKE | Human Whole Exome Sequencing Analysis Workflow(make implement) | Perl | wesMakecommon.pl |
LWP and XML::Simple |
| Python2 | wesMakecommon_urllib2.py |
urllib2 , xmltramp and json | ||
| Python3 | wesMakecommon_urllib3.py |
urllib3 , xmltramp2 and json | ||
| Java | wesMake.jar |
java8 | ||
| WGS | Human Whole Genome Sequencing Analysis Workflow | Perl | wgscommon.pl |
LWP and XML::Simple |
| Python2 | wgscommon_urllib2.py |
urllib2 , xmltramp and json | ||
| Python3 | wgscommon_urllib3.py |
urllib3 , xmltramp2 and json | ||
| Java | wgs.jar |
java8 | ||
| Upload Tool | Upload Tool provides data upload service for our WGS/WES workflow analysis. | Python2 | wgscommon_urllib2.py |
requests |
| Python3 | wgscommon_urllib2.py |
requests |